Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 2691067
End position: 2691094
Length: 28

DNA sequence
>NC_011901, from 2691067 to 2691094 (28 bp); Thioalkalivibrio sp. HL-EbGR7 TTCCCACTTCCCAATTCACACTTCCTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2691092-2691577	Sequence	Tgr7_2551 - ribonuclease activity regulator protein RraA (Protein is coded in complementary strand; from 2691577 to 2691092)