Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 2671513
End position: 2671536
Length: 24

DNA sequence
>NC_011901, from 2671513 to 2671536 (24 bp); Thioalkalivibrio sp. HL-EbGR7 AACAGCACCAGCACCAGCAGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2671207-2673507	Sequence	Tgr7_2529 - monovalent cation/H+ antiporter subunit A (Protein is coded in complementary strand; from 2673507 to 2671207)