Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 2647832
End position: 2647855
Length: 24

DNA sequence
>NC_011901, from 2647832 to 2647855 (24 bp); Thioalkalivibrio sp. HL-EbGR7 CTCCTTCTCCTTGTCCTTCTCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2647722-2648114	Sequence	Tgr7_2497 - hypothetical protein (Protein is coded in complementary strand; from 2648114 to 2647722)