Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 2613136
End position: 2613163
Length: 28

DNA sequence
>NC_011901, from 2613136 to 2613163 (28 bp); Thioalkalivibrio sp. HL-EbGR7 GCCACTTGCTACTTGCCACTAGCCACTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2613145-2614692	Sequence	Tgr7_2462 - 5-oxoprolinase (Protein is coded in complementary strand; from 2614692 to 2613145)