Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 2499587
End position: 2499619
Length: 33

DNA sequence
>NC_011901, from 2499587 to 2499619 (33 bp); Thioalkalivibrio sp. HL-EbGR7 GCGACATCACACCGACAGCACAGGGGCATCACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2498744-2499616	Sequence	Tgr7_2367 - hypothetical protein (Protein is coded in complementary strand; from 2499616 to 2498744)
ORF... 2499616-2500752	Sequence	Tgr7_2368 - glycosyl transferase family protein (Protein is coded in complementary strand; from 2500752 to 2499616)