Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 2430454
End position: 2430488
Length: 35

DNA sequence
>NC_011901, from 2430454 to 2430488 (35 bp); Thioalkalivibrio sp. HL-EbGR7 GGGGCAAGTGGCAAGTGGCAAGTGGCAAGTGGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2429726-2430454	Sequence	Tgr7_2297 - hypothetical protein (Protein is coded in complementary strand; from 2430454 to 2429726)