Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 2421256
End position: 2421283
Length: 28

DNA sequence
>NC_011901, from 2421256 to 2421283 (28 bp); Thioalkalivibrio sp. HL-EbGR7 TTTGAATATTGAATCTTGAATATTGAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2421248-2422609	Sequence	Tgr7_2292 - (dimethylallyl)adenosine tRNA methylthiotransferase (Protein is coded in complementary strand; from 2422609 to 2421248)