Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 2404359
End position: 2404386
Length: 28

DNA sequence
>NC_011901, from 2404359 to 2404386 (28 bp); Thioalkalivibrio sp. HL-EbGR7 GACAAGAGACAAGTGGCAAGAGACAAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2403906-2404439	Sequence	Tgr7_2278 - rare lipoprotein B (Protein is coded in complementary strand; from 2404439 to 2403906)