Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 2381923
End position: 2381950
Length: 28

DNA sequence
>NC_011901, from 2381923 to 2381950 (28 bp); Thioalkalivibrio sp. HL-EbGR7 TGGTCAGTAGTCAGTAGTCAGTAGTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2380518-2381933	Sequence	Tgr7_2256 - pyridine nucleotide-disulfide oxidoreductase dimerisation subunit