Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 2232467
End position: 2232494
Length: 28

DNA sequence
>NC_011901, from 2232467 to 2232494 (28 bp); Thioalkalivibrio sp. HL-EbGR7 GGTCAGGGGTCAGGGGTCAGGGGTCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2232491-2232907	Sequence	Tgr7_2107 - hypothetical protein (Protein is coded in complementary strand; from 2232907 to 2232491)