Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 2208238
End position: 2208265
Length: 28

DNA sequence
>NC_011901, from 2208238 to 2208265 (28 bp); Thioalkalivibrio sp. HL-EbGR7 CTTCGTGCTTTGTGCTTTGTGCTTTGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2207315-2208781	Sequence	Tgr7_2079 - Mannose-1-phosphate guanylyltransferase (GDP) (Protein is coded in complementary strand; from 2208781 to 2207315)