Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 2151169
End position: 2151195
Length: 27

DNA sequence
>NC_011901, from 2151169 to 2151195 (27 bp); Thioalkalivibrio sp. HL-EbGR7 GCGGCCTGGGCGGCCTCGGCGGCCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2149018-2152524	Sequence	Tgr7_2026 - chromosome segregation SMC protein (Protein is coded in complementary strand; from 2152524 to 2149018)