Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 2113843
End position: 2113870
Length: 28

DNA sequence
>NC_011901, from 2113843 to 2113870 (28 bp); Thioalkalivibrio sp. HL-EbGR7 CTTGCCACTAGCCACTTGCCACTTGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2112637-2113878	Sequence	Tgr7_1993 - secreted hydrolase-like protein (Protein is coded in complementary strand; from 2113878 to 2112637)