Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 2091554
End position: 2091577
Length: 24

DNA sequence
>NC_011901, from 2091554 to 2091577 (24 bp); Thioalkalivibrio sp. HL-EbGR7 CGCCACCGCCGCCGCCAGCGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2090001-2091659	Sequence	Tgr7_1969 - flagellar FliF M-ring protein (Protein is coded in complementary strand; from 2091659 to 2090001)