Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 2080048
End position: 2080071
Length: 24

DNA sequence
>NC_011901, from 2080048 to 2080071 (24 bp); Thioalkalivibrio sp. HL-EbGR7 GCACCAGCACCGACACCAGCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2079492-2080343	Sequence	Tgr7_1960 - sterol desaturase-like protein (Protein is coded in complementary strand; from 2080343 to 2079492)