Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 1718611
End position: 1718634
Length: 24

DNA sequence
>NC_011901, from 1718611 to 1718634 (24 bp); Thioalkalivibrio sp. HL-EbGR7 CGGCCACGGCCACGCCCACCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1717041-1719014	Sequence	Tgr7_1601 - TRAP transporter 4TM/12TM fusion protein (Protein is coded in complementary strand; from 1719014 to 1717041)