Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 1668246
End position: 1668269
Length: 24

DNA sequence
>NC_011901, from 1668246 to 1668269 (24 bp); Thioalkalivibrio sp. HL-EbGR7 CAGGCCCAGGCCCAGGACCAGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1667362-1670145	Sequence	Tgr7_1555 - transporter (Protein is coded in complementary strand; from 1670145 to 1667362)