Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 1662626
End position: 1662649
Length: 24

DNA sequence
>NC_011901, from 1662626 to 1662649 (24 bp); Thioalkalivibrio sp. HL-EbGR7 CAGGGCAAGGGCCAGGGGCAGGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1662510-1663475	Sequence	Tgr7_1550 - bile acid:sodium symporter (Protein is coded in complementary strand; from 1663475 to 1662510)