Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 1618061
End position: 1618088
Length: 28

DNA sequence
>NC_011901, from 1618061 to 1618088 (28 bp); Thioalkalivibrio sp. HL-EbGR7 CACTTCCCAATTCCCACTTCGCACTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1618087-1619247	Sequence	Tgr7_1508 - methylcitrate synthase (Protein is coded in complementary strand; from 1619247 to 1618087)