Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 1564752
End position: 1564779
Length: 28

DNA sequence
>NC_011901, from 1564752 to 1564779 (28 bp); Thioalkalivibrio sp. HL-EbGR7 AATTCAATATTCAAAATTCAAAATTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1563029-1564753	Sequence	Tgr7_1460 - single-stranded-DNA-specific exonuclease RecJ