Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 1447795
End position: 1447850
Length: 56

DNA sequence
>NC_011901, from 1447795 to 1447850 (56 bp); Thioalkalivibrio sp. HL-EbGR7 CACTCCTCACTCCTCATTCCTCACTTCTCACTCCTCACTTCTCACTTCTCACTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1447837-1448121	Sequence	Tgr7_1350 - type III secretion protein (Protein is coded in complementary strand; from 1448121 to 1447837)