Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 1372924
End position: 1372947
Length: 24

DNA sequence
>NC_011901, from 1372924 to 1372947 (24 bp); Thioalkalivibrio sp. HL-EbGR7 CGCTGGCGCCGGCGGTGGCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1372797-1373363	Sequence	Tgr7_1279 - hypothetical protein (Protein is coded in complementary strand; from 1373363 to 1372797)