Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 1119015
End position: 1119038
Length: 24

DNA sequence
>NC_011901, from 1119015 to 1119038 (24 bp); Thioalkalivibrio sp. HL-EbGR7 GGGCCAGGGCGAAGGCCAGGGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1116305-1119265	Sequence	Tgr7_1029 - two-component sensor CbrA (Protein is coded in complementary strand; from 1119265 to 1116305)