Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 1325054
End position: 1325109
Length: 56

DNA sequence
>NC_011901, from 1325054 to 1325109 (56 bp); Thioalkalivibrio sp. HL-EbGR7 CACCCTTCCCAATTCACCCTTCCCAATTCACCCTTCCCAATTCACCCTTCCCAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1325110-1325979	Sequence	Tgr7_1234 psd phosphatidylserine decarboxylase (Protein is coded in complementary strand; from 1325979 to 1325110)