Sequence retrieval

Genome: Halothermothrix orenii H 168
Start position: 642699
End position: 642728
Length: 30

DNA sequence
>NC_011899, from 642699 to 642728 (30 bp); Halothermothrix orenii H 168 TATGTTACTTTATGTTACTTTATGTTACTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 642724-642966	Sequence	Hore_05890 - AbrB family transcriptional regulator (Protein is coded in complementary strand; from 642966 to 642724)