Sequence retrieval

Genome: Halothermothrix orenii H 168
Start position: 2536842
End position: 2536886
Length: 45

DNA sequence
>NC_011899, from 2536842 to 2536886 (45 bp); Halothermothrix orenii H 168 AGTAATACTCCTTCCGATCATACTCCTTCCAGTCATACTCCTCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2534773-2536878	Sequence	Hore_23190 - alpha-glucosidase (Protein is coded in complementary strand; from 2536878 to 2534773)