Sequence retrieval

Genome: Halothermothrix orenii H 168
Start position: 2477245
End position: 2477271
Length: 27

DNA sequence
>NC_011899, from 2477245 to 2477271 (27 bp); Halothermothrix orenii H 168 TGATATTCATGATATTCCTGATATTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2476431-2477399	Sequence	Hore_22690 - monosaccharide-transporting ATPase (Protein is coded in complementary strand; from 2477399 to 2476431)