Sequence retrieval

Genome: Halothermothrix orenii H 168
Start position: 1874388
End position: 1874414
Length: 27

DNA sequence
>NC_011899, from 1874388 to 1874414 (27 bp); Halothermothrix orenii H 168 TAAAACTATTAAAATTATTAAAACTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1873834-1874430	Sequence	Hore_17520 - hypothetical protein (Protein is coded in complementary strand; from 1874430 to 1873834)