Sequence retrieval

Genome: Halothermothrix orenii H 168
Start position: 1849016
End position: 1849042
Length: 27

DNA sequence
>NC_011899, from 1849016 to 1849042 (27 bp); Halothermothrix orenii H 168 AGGTGACCGAGGTCACCGAGGTGACAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1848725-1849363	Sequence	Hore_17310 - beta-lactamase fold Zn-dependent hydrolase (Protein is coded in complementary strand; from 1849363 to 1848725)