Sequence retrieval

Genome: Halothermothrix orenii H 168
Start position: 1485915
End position: 1485944
Length: 30

DNA sequence
>NC_011899, from 1485915 to 1485944 (30 bp); Halothermothrix orenii H 168 TTAAAACTTTATAAAACTTATTAATATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1485623-1486357	Sequence	Hore_13940 - amidohydrolase 2 (Protein is coded in complementary strand; from 1486357 to 1485623)