Sequence retrieval

Genome: Halothermothrix orenii H 168
Start position: 1438013
End position: 1438042
Length: 30

DNA sequence
>NC_011899, from 1438013 to 1438042 (30 bp); Halothermothrix orenii H 168 TTTCTTTTCTATTTTTTTCTTTTCTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1437981-1439198	Sequence	Hore_13390 - cell envelope-related transcriptional attenuator (Protein is coded in complementary strand; from 1439198 to 1437981)