Sequence retrieval

Genome: Halothermothrix orenii H 168
Start position: 1321572
End position: 1321595
Length: 24

DNA sequence
>NC_011899, from 1321572 to 1321595 (24 bp); Halothermothrix orenii H 168 AAGATAATAAGAGAATAATATAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1320433-1321644	Sequence	Hore_12260 - protein-export membrane protein SecD (Protein is coded in complementary strand; from 1321644 to 1320433)