Sequence retrieval

Genome: Halothermothrix orenii H 168
Start position: 1267540
End position: 1267575
Length: 36

DNA sequence
>NC_011899, from 1267540 to 1267575 (36 bp); Halothermothrix orenii H 168 TATTTATAAAACTGTTTATAAAAATATCTAAAAAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1266393-1267601	Sequence	Hore_11720 - chloride channel protein (Protein is coded in complementary strand; from 1267601 to 1266393)