Sequence retrieval

Genome: Halothermothrix orenii H 168
Start position: 1105832
End position: 1105856
Length: 25

DNA sequence
>NC_011899, from 1105832 to 1105856 (25 bp); Halothermothrix orenii H 168 TTTTTTTTCTGTTTTATTTTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1105164-1106384	Sequence	Hore_10150 - Sporulation integral membrane protein YlbJ (Protein is coded in complementary strand; from 1106384 to 1105164)