Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis AD011
Start position: 508979
End position: 509005
Length: 27

DNA sequence
>NC_011835, from 508979 to 509005 (27 bp); Bifidobacterium animalis subsp. lactis AD011 GGTGGATTGGGTGGATTGGGTGGATTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 508977-510437	Sequence	BLA_0408 - histidine kinase sensor of two component system (Protein is coded in complementary strand; from 510437 to 508977)