Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis AD011
Start position: 254776
End position: 254823
Length: 48

DNA sequence
>NC_011835, from 254776 to 254823 (48 bp); Bifidobacterium animalis subsp. lactis AD011 GTTGTTGCTGCCGTTGTTGCTGCCGTTGTTGCTGCCGTTGTTGCTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 254666-257083	Sequence	BLA_0208 - penicillin-binding protein (Protein is coded in complementary strand; from 257083 to 254666)