Sequence retrieval

Genome: Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum)
Start position: 9569
End position: 9595
Length: 27

DNA sequence
>NC_011834, from 9569 to 9595 (27 bp); Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum) TAATTTTTTTAAATTTTTTAAGTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8911-11322	Sequence	BUAPTUC7_010 gyrB DNA gyrase subunit B (Protein is coded in complementary strand; from 11322 to 8911)