Sequence retrieval

Genome: Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum)
Start position: 608847
End position: 608876
Length: 30

DNA sequence
>NC_011834, from 608847 to 608876 (30 bp); Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum) TTTAAATAATTATAAATATTTTGAGATAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 608772-610421	Sequence	BUAPTUC7_567 pgi glucose-6-phosphate isomerase (Protein is coded in complementary strand; from 610421 to 608772)