Sequence retrieval

Genome: Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum)
Start position: 526915
End position: 526939
Length: 25

DNA sequence
>NC_011834, from 526915 to 526939 (25 bp); Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum) AAAAAACAAATAAAACAAAAAAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 525797-527668	Sequence	BUAPTUC7_472 ppiD peptidyl-prolyl cis-trans isomerase D