Sequence retrieval

Genome: Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum)
Start position: 513185
End position: 513214
Length: 30

DNA sequence
>NC_011834, from 513185 to 513214 (30 bp); Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum) GTTTTATTTTGTTTTAATATATTTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 512594-513766	Sequence	BUAPTUC7_460 yajR putative molybdenum cofactor-binding oxidoreductase (YagR) (Protein is coded in complementary strand; from 513766 to 512594)