Sequence retrieval

Genome: Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum)
Start position: 442369
End position: 442395
Length: 27

DNA sequence
>NC_011834, from 442369 to 442395 (27 bp); Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum) AAAAGAAAAACAAGAAAAAATAGAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 441324-443960	Sequence	BUAPTUC7_397 alaS alanyl-tRNA synthetase