Sequence retrieval

Genome: Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum)
Start position: 41625
End position: 41654
Length: 30

DNA sequence
>NC_011834, from 41625 to 41654 (30 bp); Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum) TTTTTCTATTTCTTTTTTTTTGTCTTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 40636-44664	Sequence	BUAPTUC7_034 rpoB DNA-directed RNA polymerase subunit beta (Protein is coded in complementary strand; from 44664 to 40636)