Sequence retrieval

Genome: Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum)
Start position: 353335
End position: 353358
Length: 24

DNA sequence
>NC_011834, from 353335 to 353358 (24 bp); Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum) ATTATGAATATGATTATGATTATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 353330-354046	Sequence	BUAPTUC7_312 znuC high-affinity zinc uptake system ATP-binding protein ZnuC (Protein is coded in complementary strand; from 354046 to 353330)