Sequence retrieval

Genome: Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum)
Start position: 309722
End position: 309746
Length: 25

DNA sequence
>NC_011834, from 309722 to 309746 (25 bp); Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum) AAAAAACAAAAAGAAAAAAATAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 309507-310517	Sequence	BUAPTUC7_280 sohB putative periplasmic protease