Sequence retrieval

Genome: Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum)
Start position: 232737
End position: 232766
Length: 30

DNA sequence
>NC_011834, from 232737 to 232766 (30 bp); Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum) TTTTTTATTTCTTTTTTTATTATTTTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 232665-233819	Sequence	BUAPTUC7_211 ftsZ cell division protein FtsZ (Protein is coded in complementary strand; from 233819 to 232665)