Sequence retrieval

Genome: Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum)
Start position: 211441
End position: 211470
Length: 30

DNA sequence
>NC_011834, from 211441 to 211470 (30 bp); Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum) TTTTTTTATAATTTTTTCTATTTCTTTATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 209279-211729	Sequence	BUAPTUC7_193 thrA bifunctional aspartokinase I/homoserine dehydrogenase I (Protein is coded in complementary strand; from 211729 to 209279)