Sequence retrieval

Genome: Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum)
Start position: 200934
End position: 200958
Length: 25

DNA sequence
>NC_011834, from 200934 to 200958 (25 bp); Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum) TTTTTTTATTTTTTCTATTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 200602-201168	Sequence	BUAPTUC7_182 grpE heat shock protein GrpE2 (Protein is coded in complementary strand; from 201168 to 200602)