Sequence retrieval

Genome: Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum)
Start position: 172985
End position: 173009
Length: 25

DNA sequence
>NC_011834, from 172985 to 173009 (25 bp); Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum) TTTTTTTTATTTTTCTTTTTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 172160-173128	Sequence	BUAPTUC7_159 nuoH NADH dehydrogenase subunit H