Sequence retrieval

Genome: Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum)
Start position: 121820
End position: 121849
Length: 30

DNA sequence
>NC_011834, from 121820 to 121849 (30 bp); Buchnera aphidicola str. Tuc7 (Acyrthosiphon pisum) AAAAAAAATCATATAAAATCAAAAATAAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 121793-122287	Sequence	BUAPTUC7_116 rnfG nitrogen fixation protein