Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 792715
End position: 792738
Length: 24

DNA sequence
>NC_011773, from 792715 to 792738 (24 bp); Bacillus cereus AH820 GAAAATTAAAATGATAATGAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 792581-792760	Sequence	BCAH820_0834 - spore germination protein (Protein is coded in complementary strand; from 792760 to 792581)